Analysis of interaction between dendriplexes and bovine serum albumin.
[EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTG...
| Autores: | , , , , , , , , , , |
|---|---|
| Formato: | artículo |
| Estado: | Versión publicada |
| Fecha de publicación: | 2007 |
| País: | España |
| Recursos: | Universidad de Salamanca (USAL) |
| Repositorio: | GREDOS. Repositorio Institucional de la Universidad de Salamanca |
| OAI Identifier: | oai:gredos.usal.es:10366/161089 |
| Acesso em linha: | http://hdl.handle.net/10366/161089 |
| Access Level: | acceso embargado |
| Palavra-chave: | Base Sequence DNA Primers Dendrimers Serum Albumin, Bovine Spectrometry, Fluorescence Serum Albumin secuencia de bases albúmina sérica dendrímeros cebadores de ADN |
| id |
ES_4746aafae2a1cff57be3ed72d1c5ec8a |
|---|---|
| oai_identifier_str |
oai:gredos.usal.es:10366/161089 |
| network_acronym_str |
ES |
| network_name_str |
España |
| repository_id_str |
|
| spelling |
Analysis of interaction between dendriplexes and bovine serum albumin.Shcharbin, DzmitryPedziwiatr, ElzbietaChonco, LouisBermejo Martín, Jesús FranciscoOrtega, Paulade la Mata, F JavierEritja, RamonGómez, RafaelKlajnert, BarbaraBryszewska, MariaMuñoz-Fernandez, Ma AngelesBase SequenceDNA PrimersDendrimersSerum Albumin, BovineSpectrometry, FluorescenceDendrimersBase SequenceDNA PrimersSerum Albuminsecuencia de basesalbúmina séricadendrímeroscebadores de ADN[EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.info202420242007info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersionhttp://hdl.handle.net/10366/161089reponame:GREDOS. Repositorio Institucional de la Universidad de Salamancainstname:Universidad de Salamanca (USAL)InglésCTQ2005-00795/BQUSAF-2004-06778SAF-2003-09209RIS G03/173PI061479FIPSE (Grant 36514/05)Grant BQU2004-02048BM04-52-0CM04/00136Marie Curie International Incoming Fellowship (Grant 510018)Kasa Mianowski FundAttribution-NonCommercial-NoDerivatives 4.0 Internacionalhttp://creativecommons.org/licenses/by-nc-nd/4.0/info:eu-repo/semantics/embargoedAccessoai:gredos.usal.es:10366/1610892026-06-07T06:28:51Z |
| dc.title.none.fl_str_mv |
Analysis of interaction between dendriplexes and bovine serum albumin. |
| title |
Analysis of interaction between dendriplexes and bovine serum albumin. |
| spellingShingle |
Analysis of interaction between dendriplexes and bovine serum albumin. Shcharbin, Dzmitry Base Sequence DNA Primers Dendrimers Serum Albumin, Bovine Spectrometry, Fluorescence Dendrimers Base Sequence DNA Primers Serum Albumin secuencia de bases albúmina sérica dendrímeros cebadores de ADN |
| title_short |
Analysis of interaction between dendriplexes and bovine serum albumin. |
| title_full |
Analysis of interaction between dendriplexes and bovine serum albumin. |
| title_fullStr |
Analysis of interaction between dendriplexes and bovine serum albumin. |
| title_full_unstemmed |
Analysis of interaction between dendriplexes and bovine serum albumin. |
| title_sort |
Analysis of interaction between dendriplexes and bovine serum albumin. |
| dc.creator.none.fl_str_mv |
Shcharbin, Dzmitry Pedziwiatr, Elzbieta Chonco, Louis Bermejo Martín, Jesús Francisco Ortega, Paula de la Mata, F Javier Eritja, Ramon Gómez, Rafael Klajnert, Barbara Bryszewska, Maria Muñoz-Fernandez, Ma Angeles |
| author |
Shcharbin, Dzmitry |
| author_facet |
Shcharbin, Dzmitry Pedziwiatr, Elzbieta Chonco, Louis Bermejo Martín, Jesús Francisco Ortega, Paula de la Mata, F Javier Eritja, Ramon Gómez, Rafael Klajnert, Barbara Bryszewska, Maria Muñoz-Fernandez, Ma Angeles |
| author_role |
author |
| author2 |
Pedziwiatr, Elzbieta Chonco, Louis Bermejo Martín, Jesús Francisco Ortega, Paula de la Mata, F Javier Eritja, Ramon Gómez, Rafael Klajnert, Barbara Bryszewska, Maria Muñoz-Fernandez, Ma Angeles |
| author2_role |
author author author author author author author author author author |
| dc.subject.none.fl_str_mv |
Base Sequence DNA Primers Dendrimers Serum Albumin, Bovine Spectrometry, Fluorescence Dendrimers Base Sequence DNA Primers Serum Albumin secuencia de bases albúmina sérica dendrímeros cebadores de ADN |
| topic |
Base Sequence DNA Primers Dendrimers Serum Albumin, Bovine Spectrometry, Fluorescence Dendrimers Base Sequence DNA Primers Serum Albumin secuencia de bases albúmina sérica dendrímeros cebadores de ADN |
| description |
[EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery. |
| publishDate |
2007 |
| dc.date.none.fl_str_mv |
2007 2024 2024 info |
| dc.type.none.fl_str_mv |
info:eu-repo/semantics/article info:eu-repo/semantics/publishedVersion |
| format |
article |
| status_str |
publishedVersion |
| dc.identifier.none.fl_str_mv |
http://hdl.handle.net/10366/161089 |
| url |
http://hdl.handle.net/10366/161089 |
| dc.language.none.fl_str_mv |
Inglés |
| language_invalid_str_mv |
Inglés |
| dc.relation.none.fl_str_mv |
CTQ2005-00795/BQU SAF-2004-06778 SAF-2003-09209 RIS G03/173 PI061479 FIPSE (Grant 36514/05) Grant BQU2004-02048 BM04-52-0 CM04/00136 Marie Curie International Incoming Fellowship (Grant 510018) Kasa Mianowski Fund |
| dc.rights.none.fl_str_mv |
Attribution-NonCommercial-NoDerivatives 4.0 Internacional http://creativecommons.org/licenses/by-nc-nd/4.0/ info:eu-repo/semantics/embargoedAccess |
| rights_invalid_str_mv |
Attribution-NonCommercial-NoDerivatives 4.0 Internacional http://creativecommons.org/licenses/by-nc-nd/4.0/ |
| eu_rights_str_mv |
embargoedAccess |
| dc.source.none.fl_str_mv |
reponame:GREDOS. Repositorio Institucional de la Universidad de Salamanca instname:Universidad de Salamanca (USAL) |
| instname_str |
Universidad de Salamanca (USAL) |
| reponame_str |
GREDOS. Repositorio Institucional de la Universidad de Salamanca |
| collection |
GREDOS. Repositorio Institucional de la Universidad de Salamanca |
| repository.name.fl_str_mv |
|
| repository.mail.fl_str_mv |
|
| _version_ |
1869407283615629312 |
| score |
15,228081 |